Rinse and Replace’: Boosting T Cell Turnover To Reduce HIV-1 Reservoirs.

Latent HIV-1 persists indefinitely during antiretroviral therapy (ART) as an integrated silent genome in long-lived memory CD4+ T cells. In untreated infections, immune activation increases the turnover of intrinsically long-lived provirus-containing CD4+ T cells.

Those are ‘washed out’ as a result of their activation, which when coupled to viral protein expression can facilitate local inflammation and recruitment of uninfected cells to activation sites, causing latently infected cells to compete for survival.

Human Hemopexin (HPX) ELISA Kit

DL-HPX-Hu-96 1 kit of 96 tests
EUR 547
Description: An ELISA kit based on the sandwich method for detection and quantification of Human Hemopexin (HPX)

Rat Hemopexin (HPX) ELISA Kit

DL-HPX-Ra-192 1 kit of 192 tests
EUR 1183
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Hemopexin (HPX)

Rat Hemopexin (HPX) ELISA Kit

DL-HPX-Ra-48 1 kit of 48 tests
EUR 493
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Hemopexin (HPX)

Rat Hemopexin (HPX) ELISA Kit

DL-HPX-Ra-96 1 kit of 96 tests
EUR 661
Description: An ELISA kit based on the sandwich method for detection and quantification of Rat Hemopexin (HPX)

Human Hemopexin (HPX) ELISA Kit

DLR-HPX-Hu-48T 48T
EUR 441
  • Should the Human Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hemopexin (HPX) in samples from serum, plasma or other biological fluids.

Human Hemopexin (HPX) ELISA Kit

DLR-HPX-Hu-96T 96T
EUR 570
  • Should the Human Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Hemopexin (HPX) in samples from serum, plasma or other biological fluids.

Rat Hemopexin (HPX) ELISA Kit

DLR-HPX-Ra-48T 48T
EUR 528
  • Should the Rat Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hemopexin (HPX) in samples from serum, plasma or other biological fluids.

Rat Hemopexin (HPX) ELISA Kit

DLR-HPX-Ra-96T 96T
EUR 690
  • Should the Rat Hemopexin (HPX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Hemopexin (HPX) in samples from serum, plasma or other biological fluids.

Human Hemopexin (HPX) ELISA Kit

RDR-HPX-Hu-48Tests 48 Tests
EUR 455

Human Hemopexin (HPX) ELISA Kit

RDR-HPX-Hu-96Tests 96 Tests
EUR 629

Rat Hemopexin (HPX) ELISA Kit

RDR-HPX-Ra-48Tests 48 Tests
EUR 558

Rat Hemopexin (HPX) ELISA Kit

RDR-HPX-Ra-96Tests 96 Tests
EUR 776

Human Hemopexin (HPX) ELISA Kit

RD-HPX-Hu-48Tests 48 Tests
EUR 436

Human Hemopexin (HPX) ELISA Kit

RD-HPX-Hu-96Tests 96 Tests
EUR 601

Rat Hemopexin (HPX) ELISA Kit

RD-HPX-Ra-48Tests 48 Tests
EUR 534

Rat Hemopexin (HPX) ELISA Kit

RD-HPX-Ra-96Tests 96 Tests
EUR 742

Mouse Hemopexin (Hpx) ELISA kit 96 tests, Quantitative

600-700-HPX 1 Kit
EUR 773

HPX Antibody

1-CSB-PA14619A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

Hpx Antibody

1-CSB-PA010723LA01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000

HPX Antibody

32919-100ul 100ul
EUR 252

HPX antibody

70R-33157 100 ug
EUR 435
Description: Rabbit polyclonal HPX antibody

HPX siRNA

20-abx902527
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HPX siRNA

20-abx919837
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HPX siRNA

20-abx919838
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

HPX Antibody

DF7415 200ul
EUR 304
Description: HPX Antibody detects endogenous levels of total HPX.

HPX Antibody

ABD7415 100 ug
EUR 438

Hemopexin (HPX) Antibody

20-abx100261
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopexin (HPX) Antibody

20-abx100262
  • EUR 356.00
  • EUR 133.00
  • EUR 996.00
  • EUR 495.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopexin (HPX) Antibody

20-abx100263
  • EUR 314.00
  • EUR 133.00
  • EUR 843.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopexin (HPX) Antibody

20-abx130204
  • EUR 439.00
  • EUR 133.00
  • EUR 1247.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Hemopexin (HPX) Antibody

20-abx110423
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

HPX Conjugated Antibody

C32919 100ul
EUR 397

HPX cloning plasmid

CSB-CL010723HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 765
  • Sequence: atggctagggtactgggagcacccgttgcactggggttgtggagcctatgctggtctctggccattgccacccctcttcctccgactagtgcccatgggaatgttgctgaaggcgagaccaagccagacccagacgtgactgaacgctgctcagatggctggagctttgatgctac
  • Show more
Description: A cloning plasmid for the HPX gene.

Rat Hemopexin (Hpx)

1-CSB-EP010723RA
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 52.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Hemopexin(Hpx) expressed in E.coli

HPX Rabbit pAb

A5603-100ul 100 ul
EUR 308

HPX Rabbit pAb

A5603-200ul 200 ul
EUR 459

HPX Rabbit pAb

A5603-20ul 20 ul
EUR 183

HPX Rabbit pAb

A5603-50ul 50 ul
EUR 223

Hpx Polyclonal Antibody

A52880 100 µg
EUR 570.55
Description: Ask the seller for details

Hemopexin (HPX) Antibody

abx018663-100ul 100 ul
EUR 342
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

20-abx004282
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

abx032918-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

abx032918-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

abx037974-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

20-abx141489
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

20-abx302284
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody

20-abx176803
  • EUR 1177.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

20-abx176804
  • EUR 1358.00
  • EUR 648.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

20-abx172765
  • EUR 718.00
  • EUR 384.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

20-abx172766
  • EUR 843.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

20-abx172767
  • EUR 871.00
  • EUR 453.00
  • 1 mg
  • 200 ug
  • Please enquire.

Hemopexin (HPX) Antibody

abx233829-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

HPX Blocking Peptide

DF7415-BP 1mg
EUR 195

Rat Hemopexin (Hpx)

1-CSB-YP010723RA
  • EUR 504.00
  • EUR 265.00
  • EUR 1832.00
  • EUR 763.00
  • EUR 1216.00
  • EUR 334.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 50.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Rat Hemopexin(Hpx) expressed in Yeast

Recombinant Hemopexin (HPX)

4-RPB986Hu01
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02790
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.7kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Hemopexin expressed in: E.coli

Recombinant Hemopexin (HPX)

4-RPB986Hu02
  • EUR 413.60
  • EUR 214.00
  • EUR 1276.00
  • EUR 492.00
  • EUR 884.00
  • EUR 340.00
  • EUR 3040.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P02790
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 18.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Hemopexin expressed in: E.coli

Recombinant Hemopexin (HPX)

4-RPB986Ra01
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20059
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 25.9kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Hemopexin expressed in: E.coli

Recombinant Hemopexin (HPX)

4-RPB986Ra02
  • EUR 422.56
  • EUR 216.00
  • EUR 1309.60
  • EUR 503.20
  • EUR 906.40
  • EUR 346.00
  • EUR 3124.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P20059
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 17.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Hemopexin expressed in: E.coli

Anti-HPX antibody

STJ27570 100 µl
EUR 277
Description: This gene encodes a plasma glycoprotein that binds heme with high affinity. The encoded protein is an acute phase protein that transports heme from the plasma to the liver and may be involved in protecting cells from oxidative stress.

Human Hemopexin (HPX) Protein

20-abx067049
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Hemopexin (HPX) Protein

20-abx067050
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Hemopexin (HPX) Protein

20-abx067051
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Rat Hemopexin (HPX) Protein

20-abx067052
  • EUR 592.00
  • EUR 258.00
  • EUR 1776.00
  • EUR 704.00
  • EUR 439.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Hemopexin (HPX) Antibody (Biotin)

20-abx106143
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (FITC)

20-abx107557
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (HRP)

20-abx108976
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Rat HPX shRNA Plasmid

20-abx985920
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal HPX / Hemopexin Antibody

APR07793G 0.1mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications:

Polyclonal HPX / Hemopexin Antibody

APR07794G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications:

Polyclonal HPX / Hemopexin Antibody

APR07795G 0.05ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HPX / Hemopexin . This antibody is tested and proven to work in the following applications:

Polyclonal HPX Antibody (Center)

APR07796G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HPX (Center). This antibody is tested and proven to work in the following applications:

HPX Antibody, HRP conjugated

1-CSB-PA14619B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

HPX Antibody, FITC conjugated

1-CSB-PA14619C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

HPX Antibody, Biotin conjugated

1-CSB-PA14619D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against HPX. Recognizes HPX from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Hpx Antibody, HRP conjugated

1-CSB-PA010723LB01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is HRP conjugated. Tested in the following application: ELISA

Hpx Antibody, FITC conjugated

1-CSB-PA010723LC01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is FITC conjugated. Tested in the following application: ELISA

Hpx Antibody, Biotin conjugated

1-CSB-PA010723LD01RA
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against Hpx. Recognizes Hpx from Rat. This antibody is Biotin conjugated. Tested in the following application: ELISA

Cow Hemopexin (HPX) Protein

20-abx653714
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hemopexin (HPX) Antibody (HRP)

20-abx316139
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (FITC)

20-abx316140
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (Biotin)

20-abx316141
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Hemopexin (HPX) Antibody (Biotin)

20-abx271774
  • EUR 398.00
  • EUR 230.00
  • EUR 1080.00
  • EUR 537.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Hemopexin (HPX) Antibody (Biotin)

20-abx273085
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse HPX shRNA Plasmid

20-abx970889
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human HPX shRNA Plasmid

20-abx952232
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

HPX protein (His tag)

80R-3694 100 ug
EUR 327
Description: Purified recombinant HPX protein (His tag)

Sheep HPX ELISA Kit

ESH0117 96Tests
EUR 521

Rat HPX ELISA Kit

ERH0117 96Tests
EUR 521

Rabbit HPX ELISA Kit

ERTH0117 96Tests
EUR 521

Mouse HPX ELISA Kit

EMH0117 96Tests
EUR 521

Monkey HPX ELISA Kit

EMKH0117 96Tests
EUR 521

Porcine HPX ELISA Kit

EPH0117 96Tests
EUR 521

Goat HPX ELISA Kit

EGTH0117 96Tests
EUR 521

Anserini HPX ELISA Kit

EAH0117 96Tests
EUR 521

Bovine HPX ELISA Kit

EBH0117 96Tests
EUR 521

Human HPX ELISA Kit

ELA-E1986h 96 Tests
EUR 824

Human HPX ELISA Kit

EHH0117 96Tests
EUR 521

Canine HPX ELISA Kit

ECH0117 96Tests
EUR 521

Chicken HPX ELISA Kit

ECKH0117 96Tests
EUR 521

HPX ELISA KIT|Human

EF006125 96 Tests
EUR 689

HPX Recombinant Protein (Human)

RP015217 100 ug Ask for price

HPX Recombinant Protein (Rat)

RP205049 100 ug Ask for price

HPX Recombinant Protein (Mouse)

RP142346 100 ug Ask for price

HPX sgRNA CRISPR Lentivector (Human) (Target 1)

K0988302 1.0 ug DNA
EUR 154

Hpx sgRNA CRISPR Lentivector (Rat) (Target 1)

K6850702 1.0 ug DNA
EUR 154

Hpx sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3830502 1.0 ug DNA
EUR 154

Rat Hemopexin (HPX) ELISA Kit

20-abx155626
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Hemopexin (HPX) ELISA Kit

20-abx151794
  • EUR 6173.00
  • EUR 3291.00
  • EUR 770.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Hemopexin(HPX) ELISA kit

CSB-EL010723HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hemopexin (HPX) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Hemopexin(HPX) ELISA kit

1-CSB-EL010723HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Hemopexin(HPX) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

De novo infection can counter this washout. During ART, inflammation and CD4+ T cell activation wane, resulting in reduced cell turnover and a persistent reservoir. We propose accelerating reservoir washout during ART by triggering sequential waves of polyclonal CD4+ T cell activation while simultaneously enhancing virus protein expression. Reservoir reduction as an adjunct to other therapies might achieve lifelong viral control.